Journal: World Journal of Gastroenterology : WJG

Article Title: Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines

doi: 10.3748/wjg.v20.i11.2979

Figure Lengend Snippet: Basal mRNA expression of acute-phase cytokines in different intestinal epithelial cell-lines. A: Tumor necrosis factor-α (TNF-α); B: Interleukin (IL-β); C: Interferon-γ (IFN-γ); D: Interleukin-6 (IL-6). The mutation is given in parenthesis. 5 × 105 cells were plated into 6 well plates and grown for 24 h. The cells were harvested, total RNA was isolated and first strand cDNA was prepared from 1 μg of total RNA. Ct values were normalized to β-actin as a housekeeping gene. The results were compared with the fold changes of Caco2 mRNA expression, taken as a control. Results represent mean ± SE (aP < 0.05 vs Caco2 analyzed by one way ANOVA, n = 4).

Article Snippet: List of human primers sequences used for polymerase chain reactions table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 KRAS siRNA sequence 5’ →3’ forward 5’ →3’ reverse Sequence 1 GCAAGUAGUAAUUGAUGGA UCCAUCAAUUACUACUUGC Sequence 2 ACAGGCUCAGGACUUAGCA UGCUAAGUCCUGAGCCUGU Sequence 3 GCAAGAAGUUAUGGAAUUCUA GAAUUCCAUAACUUCUUGCUC Open in a separate window List of KRAS siRNA sequences for knockdown table ft1 table-wrap mode="anchored" t5 Table 3 caption a7 Primary antibody Origin Dilutions primary Ab Provider β-actin Mouse 1:5000 Sigma aldrich CXCL1/GROα Goat 1:500 R and D system CXCL10/IP-10 Goat 1:500 R and D system CXCL8/IL-8 Goat 1:500 R and D system MAPK1 (ERK1/2) Rabbit 1:1000 Cell signalling IκBα Rabbit 1:10000 Abcam KRAS Rabbit 1:1000 ABBIO technology Open in a separate window List of antibodies used in Western blotting analysis Cell culture conditions and stimulation The human colon adenocarcinoma cell lines Caco2, HT-29, Colo-320, Colo-205 and DLD-1 were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Germany).

Techniques: Expressing, Mutagenesis, Isolation, Control

Journal: World Journal of Gastroenterology : WJG

Article Title: Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines

doi: 10.3748/wjg.v20.i11.2979

Figure Lengend Snippet: Basal mRNA expression of cytokine receptors in intestinal epithelial cells. A: Tumor necrosis factor-α (TNFα)- Rec1; B: Interleukin-1β (IL-1β); C: Interferon-γ (IFNγ)-Rec1. 5 × 105 cells were plated into 6 well plates and grown for 24 h. The cells were harvested, total RNA was isolated and first strand cDNA was prepared from 1 μg of total RNA. Ct values were normalized with β-actin as a housekeeping gene. The results were compared with the fold changes of Caco2 mRNA expression, taken as a control. Results represent mean ± SE (aP < 0.05, bP < 0.01 vs Caco2 analyzed by one way ANOVA, n = 4).

Article Snippet: List of human primers sequences used for polymerase chain reactions table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 KRAS siRNA sequence 5’ →3’ forward 5’ →3’ reverse Sequence 1 GCAAGUAGUAAUUGAUGGA UCCAUCAAUUACUACUUGC Sequence 2 ACAGGCUCAGGACUUAGCA UGCUAAGUCCUGAGCCUGU Sequence 3 GCAAGAAGUUAUGGAAUUCUA GAAUUCCAUAACUUCUUGCUC Open in a separate window List of KRAS siRNA sequences for knockdown table ft1 table-wrap mode="anchored" t5 Table 3 caption a7 Primary antibody Origin Dilutions primary Ab Provider β-actin Mouse 1:5000 Sigma aldrich CXCL1/GROα Goat 1:500 R and D system CXCL10/IP-10 Goat 1:500 R and D system CXCL8/IL-8 Goat 1:500 R and D system MAPK1 (ERK1/2) Rabbit 1:1000 Cell signalling IκBα Rabbit 1:10000 Abcam KRAS Rabbit 1:1000 ABBIO technology Open in a separate window List of antibodies used in Western blotting analysis Cell culture conditions and stimulation The human colon adenocarcinoma cell lines Caco2, HT-29, Colo-320, Colo-205 and DLD-1 were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Germany).

Techniques: Expressing, Isolation, Control

Journal: World Journal of Gastroenterology : WJG

Article Title: Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines

doi: 10.3748/wjg.v20.i11.2979

Figure Lengend Snippet: Basal mRNA expression of chemokines in intestinal epithelial cells. A: CXCL1; B: CXCL8; C: CXCL10. 5 × 105 cells were plated into 6 well plates and grown for 24 h. The cells were harvested, total RNA was isolated and first strand cDNA was prepared from 1 μg of total RNA. Ct values were normalized with β-actin as a housekeeping gene. The results were compared with the fold changes of Caco2 mRNA expression, taken as a control. Results represent mean ± SE (aP < 0.05, bP < 0.01 vs Caco2 analyzed by one way ANOVA, n = 4). CXCL1: Chemokine (C-X-C motif) ligand 1.

Article Snippet: List of human primers sequences used for polymerase chain reactions table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 KRAS siRNA sequence 5’ →3’ forward 5’ →3’ reverse Sequence 1 GCAAGUAGUAAUUGAUGGA UCCAUCAAUUACUACUUGC Sequence 2 ACAGGCUCAGGACUUAGCA UGCUAAGUCCUGAGCCUGU Sequence 3 GCAAGAAGUUAUGGAAUUCUA GAAUUCCAUAACUUCUUGCUC Open in a separate window List of KRAS siRNA sequences for knockdown table ft1 table-wrap mode="anchored" t5 Table 3 caption a7 Primary antibody Origin Dilutions primary Ab Provider β-actin Mouse 1:5000 Sigma aldrich CXCL1/GROα Goat 1:500 R and D system CXCL10/IP-10 Goat 1:500 R and D system CXCL8/IL-8 Goat 1:500 R and D system MAPK1 (ERK1/2) Rabbit 1:1000 Cell signalling IκBα Rabbit 1:10000 Abcam KRAS Rabbit 1:1000 ABBIO technology Open in a separate window List of antibodies used in Western blotting analysis Cell culture conditions and stimulation The human colon adenocarcinoma cell lines Caco2, HT-29, Colo-320, Colo-205 and DLD-1 were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Germany).

Techniques: Expressing, Isolation, Control

Journal: World Journal of Gastroenterology : WJG

Article Title: Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines

doi: 10.3748/wjg.v20.i11.2979

Figure Lengend Snippet: Caco2 (Wt), DLD-1 (KRAS) and HT-29 (BRAF) Western blotting analysis. The bands represent chemokine (C-X-C motif) ligand (CXCL)-1 protein expression (upper panel) at different time points after stimulation of Caco2 (A), DLD-1 (B) and HT-29 (C) cell lines with tumor necrosis factor-α (TNFα) (50 ng/mL), interleukin (IL)-1beta (1 ng/mL) and interferon (IFN)-gamma (50 ng/mL) compared to the loading control betabb-actin (lower panel).

Article Snippet: List of human primers sequences used for polymerase chain reactions table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 KRAS siRNA sequence 5’ →3’ forward 5’ →3’ reverse Sequence 1 GCAAGUAGUAAUUGAUGGA UCCAUCAAUUACUACUUGC Sequence 2 ACAGGCUCAGGACUUAGCA UGCUAAGUCCUGAGCCUGU Sequence 3 GCAAGAAGUUAUGGAAUUCUA GAAUUCCAUAACUUCUUGCUC Open in a separate window List of KRAS siRNA sequences for knockdown table ft1 table-wrap mode="anchored" t5 Table 3 caption a7 Primary antibody Origin Dilutions primary Ab Provider β-actin Mouse 1:5000 Sigma aldrich CXCL1/GROα Goat 1:500 R and D system CXCL10/IP-10 Goat 1:500 R and D system CXCL8/IL-8 Goat 1:500 R and D system MAPK1 (ERK1/2) Rabbit 1:1000 Cell signalling IκBα Rabbit 1:10000 Abcam KRAS Rabbit 1:1000 ABBIO technology Open in a separate window List of antibodies used in Western blotting analysis Cell culture conditions and stimulation The human colon adenocarcinoma cell lines Caco2, HT-29, Colo-320, Colo-205 and DLD-1 were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Germany).

Techniques: Western Blot, Expressing, Control

Journal: World Journal of Gastroenterology : WJG

Article Title: Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines

doi: 10.3748/wjg.v20.i11.2979

Figure Lengend Snippet: Shows Caco2 (Wt) (A), DLD-1 (KRAS) (B) and HT-29 (BRAF) (C) Western blotting analysis. The cytokines interleukin-1β (1 ng/mL), tumor necrosis factor α (50 ng/mL) and interferon-γ (50 ng/mL) were stimulated to the cells and the total cell lysates was isolated and 20 μg were separated by 15%-20% NuPAGE Bis-Tris gel electrophoresis, blotted and probed with chemokine (C-X-C motif) ligand (CXCL) 10 antibody. β-actin (43 kDa) was analyzed as an internal control.

Article Snippet: List of human primers sequences used for polymerase chain reactions table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 KRAS siRNA sequence 5’ →3’ forward 5’ →3’ reverse Sequence 1 GCAAGUAGUAAUUGAUGGA UCCAUCAAUUACUACUUGC Sequence 2 ACAGGCUCAGGACUUAGCA UGCUAAGUCCUGAGCCUGU Sequence 3 GCAAGAAGUUAUGGAAUUCUA GAAUUCCAUAACUUCUUGCUC Open in a separate window List of KRAS siRNA sequences for knockdown table ft1 table-wrap mode="anchored" t5 Table 3 caption a7 Primary antibody Origin Dilutions primary Ab Provider β-actin Mouse 1:5000 Sigma aldrich CXCL1/GROα Goat 1:500 R and D system CXCL10/IP-10 Goat 1:500 R and D system CXCL8/IL-8 Goat 1:500 R and D system MAPK1 (ERK1/2) Rabbit 1:1000 Cell signalling IκBα Rabbit 1:10000 Abcam KRAS Rabbit 1:1000 ABBIO technology Open in a separate window List of antibodies used in Western blotting analysis Cell culture conditions and stimulation The human colon adenocarcinoma cell lines Caco2, HT-29, Colo-320, Colo-205 and DLD-1 were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Germany).

Techniques: Western Blot, Isolation, Nucleic Acid Electrophoresis, Control

Journal: World Journal of Gastroenterology : WJG

Article Title: Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines

doi: 10.3748/wjg.v20.i11.2979

Figure Lengend Snippet: The figure shows the results of KRAS inhibition from transient transfection of KRAS siRNA in DLD-1 and Caco2 cell lines at RNA and protein level. A-D: Relative expression of KRAS at RNA-level by RT-PCR (A and B) and protein expression by Western blotting (C and D) at 48 h and 72 h after KRAS inhibition; E, F: Note the significant down-regulation of KRAS at 48 and 72 h at protein level by densitometric analysis in both, DLD1 and Caco2 cell-lines. Changes are shown in percent, compared to scrambled siRNA. Data are presented as mean ± SE of 3 independent experiments with double confirmation. aP < 0.05 vs scrambled 72 h.

Article Snippet: List of human primers sequences used for polymerase chain reactions table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 KRAS siRNA sequence 5’ →3’ forward 5’ →3’ reverse Sequence 1 GCAAGUAGUAAUUGAUGGA UCCAUCAAUUACUACUUGC Sequence 2 ACAGGCUCAGGACUUAGCA UGCUAAGUCCUGAGCCUGU Sequence 3 GCAAGAAGUUAUGGAAUUCUA GAAUUCCAUAACUUCUUGCUC Open in a separate window List of KRAS siRNA sequences for knockdown table ft1 table-wrap mode="anchored" t5 Table 3 caption a7 Primary antibody Origin Dilutions primary Ab Provider β-actin Mouse 1:5000 Sigma aldrich CXCL1/GROα Goat 1:500 R and D system CXCL10/IP-10 Goat 1:500 R and D system CXCL8/IL-8 Goat 1:500 R and D system MAPK1 (ERK1/2) Rabbit 1:1000 Cell signalling IκBα Rabbit 1:10000 Abcam KRAS Rabbit 1:1000 ABBIO technology Open in a separate window List of antibodies used in Western blotting analysis Cell culture conditions and stimulation The human colon adenocarcinoma cell lines Caco2, HT-29, Colo-320, Colo-205 and DLD-1 were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Germany).

Techniques: Inhibition, Transfection, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot

Journal: World Journal of Gastroenterology : WJG

Article Title: Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines

doi: 10.3748/wjg.v20.i11.2979

Figure Lengend Snippet: Transient transfection of KRAS siRNA in DLD-1 (KRAS) and Caco2 (Wt) cell line. Expression of chemokine (C-X-C motif) ligand (CXCL)-1/Gro-alpha (A) and CXCL10/IP-10 (B) in the DLD-1 (KRAS-mutant) cell-line. Expression of CXCL-1/Gro-alpha (C) and CXCL-10/IP-10 (D) in the Caco2 (WT) cell-line. 5 × 104 cells were plated into 24 well plates and grown for 24 h and then transfected with KRAS siRNA or scrambled (20 nmol/L) for 72 h. Real time PCR was performed for chemokine CXCL1 and CXCL10 with gene specific primers and the expression was normalized to β-actin expression measured in the same sample as an internal control. Data presented are the mean ± SE of 4 independent experiments with double confirmation. aP < 0.05 vs scrambled 72 h.

Article Snippet: List of human primers sequences used for polymerase chain reactions table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 KRAS siRNA sequence 5’ →3’ forward 5’ →3’ reverse Sequence 1 GCAAGUAGUAAUUGAUGGA UCCAUCAAUUACUACUUGC Sequence 2 ACAGGCUCAGGACUUAGCA UGCUAAGUCCUGAGCCUGU Sequence 3 GCAAGAAGUUAUGGAAUUCUA GAAUUCCAUAACUUCUUGCUC Open in a separate window List of KRAS siRNA sequences for knockdown table ft1 table-wrap mode="anchored" t5 Table 3 caption a7 Primary antibody Origin Dilutions primary Ab Provider β-actin Mouse 1:5000 Sigma aldrich CXCL1/GROα Goat 1:500 R and D system CXCL10/IP-10 Goat 1:500 R and D system CXCL8/IL-8 Goat 1:500 R and D system MAPK1 (ERK1/2) Rabbit 1:1000 Cell signalling IκBα Rabbit 1:10000 Abcam KRAS Rabbit 1:1000 ABBIO technology Open in a separate window List of antibodies used in Western blotting analysis Cell culture conditions and stimulation The human colon adenocarcinoma cell lines Caco2, HT-29, Colo-320, Colo-205 and DLD-1 were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Germany).

Techniques: Transfection, Expressing, Mutagenesis, Real-time Polymerase Chain Reaction, Control

Journal: World Journal of Gastroenterology : WJG

Article Title: Differential gene expression of chemokines in KRAS and BRAF mutated colorectal cell lines: Role of cytokines

doi: 10.3748/wjg.v20.i11.2979

Figure Lengend Snippet: Effect of MAPK1 and IκBα protein expression in DLD-1 and Caco2 cells after KRAS knockdown. Proteins (20 μg) from whole-cell lysates were size-fractionated by SDS-PAGE and transferred on to membranes, and incubated with antibodies as indicated. Representative Western blotting of mitogen-activated protein kinase (MARK)-1 (44 kDa) and IκBα (41 kDa) proteins in DLD-1 cells (A) and Caco2 cells (D). Densitometric analysis of MAPK-1 (B and C) and IκBα proteins (E and F) in DLD-1 cells and Caco2 cells. Proteins were densitometrically quantified and expressed as percent increase or decrease compared with scrambled controls. Equal loading of total proteins were ensured by β-actin (43 kDa). Data presented are the mean ± SE of 3 independent experiments with double confirmation. aP < 0.05 vs scrambled.

Article Snippet: List of human primers sequences used for polymerase chain reactions table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 KRAS siRNA sequence 5’ →3’ forward 5’ →3’ reverse Sequence 1 GCAAGUAGUAAUUGAUGGA UCCAUCAAUUACUACUUGC Sequence 2 ACAGGCUCAGGACUUAGCA UGCUAAGUCCUGAGCCUGU Sequence 3 GCAAGAAGUUAUGGAAUUCUA GAAUUCCAUAACUUCUUGCUC Open in a separate window List of KRAS siRNA sequences for knockdown table ft1 table-wrap mode="anchored" t5 Table 3 caption a7 Primary antibody Origin Dilutions primary Ab Provider β-actin Mouse 1:5000 Sigma aldrich CXCL1/GROα Goat 1:500 R and D system CXCL10/IP-10 Goat 1:500 R and D system CXCL8/IL-8 Goat 1:500 R and D system MAPK1 (ERK1/2) Rabbit 1:1000 Cell signalling IκBα Rabbit 1:10000 Abcam KRAS Rabbit 1:1000 ABBIO technology Open in a separate window List of antibodies used in Western blotting analysis Cell culture conditions and stimulation The human colon adenocarcinoma cell lines Caco2, HT-29, Colo-320, Colo-205 and DLD-1 were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Germany).

Techniques: Expressing, Knockdown, SDS Page, Incubation, Western Blot

Journal: Frontiers in Microbiology

Article Title: Lacticaseibacillus casei Strain T21 Attenuates Clostridioides difficile Infection in a Murine Model Through Reduction of Inflammation and Gut Dysbiosis With Decreased Toxin Lethality and Enhanced Mucin Production

doi: 10.3389/fmicb.2021.745299

Figure Lengend Snippet: The Lacticaseibacillus casei -conditioned medium (LCM) of L. casei T21 attenuated C. difficile -induced IL-8 production, host gene expression, and increased transepithelial electrical resistance of C. difficile -stimulated colonic epithelial cells. The results are shown as IL-8 production in Caco-2 and HT-29 cells, respectively (A,B) ; IL-8 gene expression (relative to GAPDH ) in Caco-2 and HT-29 cells, respectively (C,D) ; the expression of SLC11A1 , HuR , and MUC-2 in Caco-2 cells, respectively (E–G) ; the expression of SLC11A1 , HuR , and MUC-2 in HT-29 cells, respectively (H–J) ; the transepithelial electrical resistance (TEER) values of Caco-2 cells (K) ; and the pH of cell culture medium (McCoy’s 5A modified medium for HT-29 cells) (L) . The results were from three independent experiments each in triplicate and expressed as the mean ± SEM. *p < 0.05.

Article Snippet: Colonic epithelial cells were then incubated with viable cells of C. difficile ATCC BAA1870 at multiplicity of infection (MOI) 1:300 either alone or with 5% (vol/vol) LCM for 24 h in 5% CO 2 at 37°C.

Techniques: Gene Expression, Expressing, Cell Culture, Modification

Journal: Journal of immunotherapy (Hagerstown, Md. : 1997)

Article Title: Targeting the Intratumoral Dendritic Cells by the Oncolytic Adenoviral Vaccine Expressing RANTES Elicits Potent Antitumor Immunity

doi: 10.1097/CJI.0b013e318193d31e

Figure Lengend Snippet: CTL and NK cell responses were induced by Ad-RANTES-E1A intratumoral vaccination in JC and E.G-7 tumor models. Spleens were harvested from tumor-bearing mice. Splenocytes were tested for cytolytic activity in a standard 6-hour 51Cr-release assay. A, Upper panel, CTLs (1.5 × 106 cells) were stimulated with JC tumor lysates at a T cell:JC tumor cell ratio of 2:1 for 5 days. Target cells labeled with 51Cr were placed in each well of 96-well plates, and 50 μL of effector T cells for each dilution was added. The supernatant from each well was harvested, and the amount of 51Cr radioactivity released was measured in a γ counter. Lower panel, JC-specific CTL response in Ad-RANTES-E1A–treated mice. 51Cr-labeled CT26 colon carcinoma cells were used as syngeneic negative control. About 2 μg of monoclonal antimouse CD8 mAbs were added for the blocking assay; excess of Yac-1 cells was added to block NK cell activity (negative control). E:T ratio is 100:1. B, Spleens were harvested from E.G-7–bearing mice. Upper panel, CTLs were stimulated with 10 μg/mL of OT-I peptide for 5 days. E.G-7 target cells labeled with 51Cr were placed in each well of 96-well plates, and 50 μl of effector T cells for each dilution was added. The supernatant from each well was harvested, and the amount of 51Cr radioactivity released was measured in a γ counter. Lower panel, E.G-7–specific CTL response in Ad-RANTES-E1A–treated mice. 51Cr-labeled EL-4 cells were used as negative control. About 2 μg of monoclonal antimouse CD8 mAbs were added for the blocking assay; excess of Yac-1 cells was added to block NK cell activity; E:T ratio is 100:1. The assays were performed 3 times or more. C. Total spleen (upper panel) and tumor (lower panel) cell suspensions were stained with antimouse DX5+ Ab and percentage of DX5+ NK cells was evaluated by flow cytometry in 3 mice of each group. D, NK functional response was induced by Ad-RANTES-E1A intratumoral vaccination. Upper panel, splenocytes from Ad-RANTES-E1A, Ad-E1A, or PBS-treated mice were purified and cultured overnight in complete medium with 20 U/mL of IL-2. About 2 × 105 splenocytes were plated in 96-well plates and incubated with 51Cr labeled Yac-1 cells. Lower panel, NK cells from Ad-RANTES E1A mice were cocultured with 51Cr-labeled CT26 (negative control) and with antimouse NK blocking Ab (PK 136) for 6 hours at 37°C and 5% CO2. The assays were performed 3 times in triplicates. CTL indicates cytotoxic T lymphocyte; E:T, effector:target; IL, interleukin; mAbs, monoclonal antibodies; NK, natural killer; PBS, phosphate buffered saline; RANTES, regulated upon activation, normally T expressed, and presumably secreted.

Article Snippet: Cell Lines and Animals JC murine mammary adenocarcinoma, CT26 murine colon carcinoma, EL-4 lymphoma, E.G-7 lymphoma [ovalbumin (OVA)-transfected clone derived from murine EL-4 lymphoma], B16 melanoma, human embryonic kidney cells (HEK-293), and Yac-1 cells were purchased from American Type Culture Collection Inc (Manassas, VA).

Techniques: Activity Assay, Release Assay, Labeling, Radioactivity, Negative Control, Blocking Assay, Staining, Flow Cytometry, Functional Assay, Purification, Cell Culture, Incubation, Bioprocessing, Saline, Activation Assay

Journal: Molecular cancer therapeutics

Article Title: Atovaquone: An antiprotozoal drug, suppresses primary and resistant breast tumor growth by inhibiting HER2/β-catenin signaling

doi: 10.1158/1535-7163.MCT-18-1286

Figure Lengend Snippet: A) HCC1806, B) SKBR3, C) MCF-7, D) 4T1, E) T47D, F) CI66 cells were treated with increasing concentrations of atovaquone for 24, 48 and 72h. Cell survival was measured with sulforhodamine B (SRB) assay to estimate the IC50 values. Patient derived cell lines G) TX-BR-237 and H) TX-BR-290 were also evaluated for cytotoxic effect of atovaquone. The experiments were repeated at least three times with 8 replicates in each experiment. Colony formation assay was performed by seeding 400–600 cells/well. 4T1 cells were fixed and stained using crystal violet (0.5%) after 9 days and MCF-7 cells after 14 days. Number of colonies formed in control and atovaquone treated wells were quantitated using Image J software. Representative Images of colonies and their quantification in (I-J) 4T1 cells and (K-L) MCF-7 cells. Data shown as mean ± SD; (n=3). Student’s t test for unpaired samples was used to perform statistical comparisons.

Article Snippet: Human breast carcinoma cell lines MCF-7, HCC1806, T47D and murine breast cancer cells 4T1 were obtained from ATCC and were maintained in DMEM supplemented with 10% FBS, 1% PSN (Penicillin, Streptomycin and Neomycin).

Techniques: Sulforhodamine B Assay, Derivative Assay, Colony Assay, Staining, Control, Software

Journal: Molecular cancer therapeutics

Article Title: Atovaquone: An antiprotozoal drug, suppresses primary and resistant breast tumor growth by inhibiting HER2/β-catenin signaling

doi: 10.1158/1535-7163.MCT-18-1286

Figure Lengend Snippet: A) SKBR3, B) HCC1806, C) 4T1, D) MCF-7 cells was treated with or without atovaquone (10, 20 and 30 µM) for 72h. Cells were then collected and labeled with Annexin V FITC. Cells that were positive for Annexin or PI or both were measured using flowcytometry. Each experiment was repeated more than three times independently. E) Western blots analyses representing the basal level of HER2 and β-catenin in breast cancer cells. *Statistically different when compared with control (p<0.05).

Article Snippet: Human breast carcinoma cell lines MCF-7, HCC1806, T47D and murine breast cancer cells 4T1 were obtained from ATCC and were maintained in DMEM supplemented with 10% FBS, 1% PSN (Penicillin, Streptomycin and Neomycin).

Techniques: Labeling, Western Blot, Control

Journal: Molecular cancer therapeutics

Article Title: Atovaquone: An antiprotozoal drug, suppresses primary and resistant breast tumor growth by inhibiting HER2/β-catenin signaling

doi: 10.1158/1535-7163.MCT-18-1286

Figure Lengend Snippet: A) SKBR3, B) 4T1, C) MCF-7 and D) HCC1806, cells were treated with varying concentrations of atovaquone for 72h. Representative blots showing the concentration dependent effect of atovaquone on p-HER2, HER2, β-catenin, p-GSK3β, GSK3β c-Myc, TCF-4, TCF-1 cyclin D1, MMP-7, cleaved caspase 3, cleaved PARP. Actin was used as loading control. Each experiment was repeated three times independently.

Article Snippet: Human breast carcinoma cell lines MCF-7, HCC1806, T47D and murine breast cancer cells 4T1 were obtained from ATCC and were maintained in DMEM supplemented with 10% FBS, 1% PSN (Penicillin, Streptomycin and Neomycin).

Techniques: Concentration Assay, Control

Journal: Molecular cancer therapeutics

Article Title: Atovaquone: An antiprotozoal drug, suppresses primary and resistant breast tumor growth by inhibiting HER2/β-catenin signaling

doi: 10.1158/1535-7163.MCT-18-1286

Figure Lengend Snippet: A) About 0.07 × 106 4T1 and 0.1X106 CI66 breast cancer cells were injected orthotropically in the right and left mammary fat pads of 4 to 6 weeks old Balb/c female mice. Mice were given 30 mg/kg of atovaquone by oral gavage every day till day 25. A) Tumor growth curve in 4T1 cells. Values were plotted as mean ± SEM. B) Orthotropically implanted 4T1 tumors were removed aseptically after terminating the experiments. Tumors were homogenized, lysed, and analyzed for HER2, β-catenin, c-Myc, c-caspase-3 and c-PARP. Blots were stripped and reprobed with actin antibody to verify equal protein loading; each lane of blot represents tumor from individual mouse. C) Tumors were sectioned and immunostained for HER2, β-catenin and c-caspase-3. D) Representative images from control and atovaquone treated 4T1 tumors by TUNEL assay. E) Tumor growth curve in CI66 cells. Values were plotted as mean ± SEM. F) Effect of atovaquone on CI66 tumor weight. G) CI66 tumors were minced, lysed and analyzed for HER2, β-catenin, c-Myc, and c-caspase-3 and c-PARP. Each band represents tumor from individual mouse. H) Weight of the mice during the study.

Article Snippet: Human breast carcinoma cell lines MCF-7, HCC1806, T47D and murine breast cancer cells 4T1 were obtained from ATCC and were maintained in DMEM supplemented with 10% FBS, 1% PSN (Penicillin, Streptomycin and Neomycin).

Techniques: Injection, Control, TUNEL Assay